View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20200_low_11 (Length: 249)
Name: NF20200_low_11
Description: NF20200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20200_low_11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 8552536 - 8552287
Alignment:
| Q |
1 |
aaatgagtgactagagtattaatttgatttattgatggttatagcacgtgagtgagttataaataagtactgtagacagagatttaggtggggaccaatg |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8552536 |
aaatgagtcactagagtattaatttgatttattaatggttatagcacgtgagtgagttataaataagtactgtagacagagatttaggtggggaccaatg |
8552437 |
T |
 |
| Q |
101 |
aagccatttttgtcagtggtgtggtcttaaggaactgacaacttgtacggcaagtttggttttc-nnnnnnnctcattgtctgattcatattattaatat |
199 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8552436 |
aagccatctttgtcagtggtgtggtcttaaggaactgacaacttgtacggcaagtttggttttcttttttttctcattgtctgattcatattattaatat |
8552337 |
T |
 |
| Q |
200 |
cttcttatgctatagtatagagatagagatacagctttattttatgtatc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8552336 |
cttcttatgctatagtatagagatagagatacagctttattttatgtatc |
8552287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University