View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20201_low_2 (Length: 312)
Name: NF20201_low_2
Description: NF20201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20201_low_2 |
 |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 64 - 292
Target Start/End: Original strand, 41413665 - 41413891
Alignment:
| Q |
64 |
acatatattctaaagaaaaatggtatatattctttaactataacaattacaatttatctcactcaatattctcatttttaacacatacaaacacacatac |
163 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41413665 |
acatatattctaaagaaaaatggtata--ttctttaactataacaattacaatttatctcactcaatattctcatttttaacacatacaaacacacatac |
41413762 |
T |
 |
| Q |
164 |
atacatgctaatttctttgcattattgtgatgtgttttcaggcaatatcaatttccagaaccaatgcttcctccacataaatgtcatctcttcaatggga |
263 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41413763 |
atacatgttaatttctttgcattattgtgatgtgttttcaggcaatatcaatttccagaaccaatgcttcctccacataaatgtcatctcttcaatggga |
41413862 |
T |
 |
| Q |
264 |
atacctctggtttcaggcaagaacagaat |
292 |
Q |
| |
|
|||||| |||||||||||||||||||||| |
|
|
| T |
41413863 |
atacctttggtttcaggcaagaacagaat |
41413891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 41405929 - 41405991
Alignment:
| Q |
1 |
aatttaatgtatgtttagtgggtttgtcattttgtttcttctgcaaaataagattaaaacata |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41405929 |
aatttaatgtatgtttagtgggtttgtcattttgtttcttctgcaaaataagattaaaacata |
41405991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 184 - 291
Target Start/End: Original strand, 36293310 - 36293417
Alignment:
| Q |
184 |
attattgtgatgtgttttcaggcaatatcaatttccagaaccaatgcttcctccacataaatgtcatctcttcaatgggaatacctctggtttcaggcaa |
283 |
Q |
| |
|
|||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36293310 |
attactgtgatgtgtttacaggcaatatcgatttccagaaccaatgcttcctccacataaatgacatctcttcaatgggaatacctttggtttcaggcaa |
36293409 |
T |
 |
| Q |
284 |
gaacagaa |
291 |
Q |
| |
|
|||||||| |
|
|
| T |
36293410 |
gaacagaa |
36293417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 215 - 280
Target Start/End: Complemental strand, 20599 - 20534
Alignment:
| Q |
215 |
tttccagaaccaatgcttcctccacataaatgtcatctcttcaatgggaatacctctggtttcagg |
280 |
Q |
| |
|
||||||||||||||| |||||| ||| || || |||||||||||||||||| || |||||||||| |
|
|
| T |
20599 |
tttccagaaccaatgtttcctcaacaaaattgacatctcttcaatgggaatgcccttggtttcagg |
20534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 215 - 280
Target Start/End: Complemental strand, 48333077 - 48333012
Alignment:
| Q |
215 |
tttccagaaccaatgcttcctccacataaatgtcatctcttcaatgggaatacctctggtttcagg |
280 |
Q |
| |
|
||||||||||||||| |||||| ||| || || |||||||||||||||||| || |||||||||| |
|
|
| T |
48333077 |
tttccagaaccaatgtttcctcaacaaaattgacatctcttcaatgggaatgcccttggtttcagg |
48333012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University