View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20202_low_10 (Length: 344)
Name: NF20202_low_10
Description: NF20202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20202_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 1 - 328
Target Start/End: Original strand, 5871409 - 5871736
Alignment:
| Q |
1 |
tgatagaggcatctattgcctctttgaaggtgggactcctgattcaaaacttgattggggcccatctttcatttgcaaagatgacactgcttattcagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5871409 |
tgatagaggcatctattgcctctttgaaggtgggactcctgattcaaaacttgattggggcccatctttcatttgcaaagatgacactgcttattcagat |
5871508 |
T |
 |
| Q |
101 |
ggcaccggaaacctcgatagtggagagggctatcaagctgcacctgacattgatcatctcaatcctcaagtacaaaaagagttatctgaatggatgaatt |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5871509 |
ggcactggaaacctcgatagtggagagggctatcaagctgcacctgacattgatcatctcaatcctcaagtacaaaaagagttatctgaatggatgaatt |
5871608 |
T |
 |
| Q |
201 |
ggctcaaaactgaaattggattttctggttggagatttgattttgtcaaaggttatgcgcctagcataacaaaaatttatatggaaaatacttcgccaga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5871609 |
ggctcaaaactgaaattggattttctggttggagatttgattttgtcaaaggttatgcgcctagcataacaaaaatttatatggaaaatacttcgccaga |
5871708 |
T |
 |
| Q |
301 |
ttttgccgtgggagaatattggaattcg |
328 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5871709 |
ttttgccgtgggagaatattggaattcg |
5871736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University