View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20202_low_12 (Length: 332)
Name: NF20202_low_12
Description: NF20202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20202_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 9 - 268
Target Start/End: Original strand, 4949211 - 4949487
Alignment:
| Q |
9 |
gagatgaatttaacggtctactcaatctcaatcattgacttagaacggacaacggatgttggtaattgtgtgacacaattacttcagaaatccaattcca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4949211 |
gagatgaatttaacggtctactcaatctcaatcattgacttagaacggacaacggatgttggtaattgtgtgacacaattacttcagaaatccaattcca |
4949310 |
T |
 |
| Q |
109 |
tacatcaattgaccagctcaaatcctctcatttatgtt-----------------gtcagtagttgaaaactgtcgaatcactgacctcattttagaacc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
4949311 |
tacatcaattgaccagctcaaatcctctcatttatgctgtcagtccaaaattgaggtcagtagttgaaaactgtcaaatcactgacctcaatttagaacc |
4949410 |
T |
 |
| Q |
192 |
gactgtaaaaacgagagagactccaagttcatcatttatcaccaaaaccatctttactaaattcaatttttcttgaa |
268 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
4949411 |
gactgcaaaaacgagagagactccaagttcatcatttatcaccaaaactatctttactaaattcaatttttcatgaa |
4949487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University