View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20202_low_14 (Length: 292)
Name: NF20202_low_14
Description: NF20202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20202_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 17 - 281
Target Start/End: Original strand, 46133761 - 46134025
Alignment:
| Q |
17 |
gtttcttaatgcgattgagatcttgtgaattgcgatcaatttgaagaacggcgtaccaatcgaggtggtggttgttgagattgagaggcttctccgccgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46133761 |
gtttcttaatgcgattgagatcttgtgaattgcgatcaatttgaagaacggcgtaccaatcgaggtggtggttgttgagattgagaggcttctccgccgc |
46133860 |
T |
 |
| Q |
117 |
ttcgagaacatcaacaattgcgaggatctgatcggaaccttcaagaagaggttcggtttcttgaaccagattcgcaatttctcttgaacctttgagatct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46133861 |
ttcgagaacatcaacaattgcgaggatctgatcggaaccttcaagaagaggttcggtttcttgaaccagattcgcaatttctcttgaacctttgagatct |
46133960 |
T |
 |
| Q |
217 |
cttttctgcaagagttcttctccgatttcaagtaaccgttctgcttcggctttgcttgtgttcat |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46133961 |
cttttctgcaagagttcttctccgatttcaagtaaccgttctgcttcggctttgcttgtgttcat |
46134025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 179
Target Start/End: Original strand, 27862997 - 27863035
Alignment:
| Q |
141 |
gatctgatcggaaccttcaagaagaggttcggtttcttg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27862997 |
gatctgatcggaaccttcaagaaggggttcggtttcttg |
27863035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University