View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20202_low_17 (Length: 251)
Name: NF20202_low_17
Description: NF20202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20202_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 35784253 - 35784465
Alignment:
| Q |
1 |
aatgttactttcttttagactagtttatgtgtttcgttggatcgaatatcccttggaatttttgtggtttggaggatcaaatactatttg--tatttctc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
35784253 |
aatgttactttcttttagactagtttatgtgtttcgttggatcgaatatcccttggaatttttgtggtttgaaggatcaaatactatttgtatatttctc |
35784352 |
T |
|
| Q |
99 |
ttattctatctataaaaattcattttacagctannnnnnnnataggtaaagttgtaagtttagttaagcctttccgactctagcaccaagttagtaaagg |
198 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||| |||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35784353 |
ttattctatctataaaaattcgttttacagct-ttttttttataggtaaagatgtaggttgagttaagcctttccgactctagcaccaagttagtaaagg |
35784451 |
T |
|
| Q |
199 |
ataaagaatctctc |
212 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35784452 |
ataaagaatctctc |
35784465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University