View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20202_low_22 (Length: 235)
Name: NF20202_low_22
Description: NF20202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20202_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 18890480 - 18890694
Alignment:
| Q |
18 |
aaaaaagggttaatcgagattaataaacattgatttctcattatgtggcacagcaacactacaatataatttgagtttcatcgcgatttagagattaaac |
117 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
18890480 |
aaaaatgggttaatcgagatttataaacattgatttctcattatgtggcacagcaacactgcaatataatttgagtttcatcgcgattcagagtttaaac |
18890579 |
T |
|
| Q |
118 |
aaaaccacaagccaatttcaacaatcaatggtttattcatggattcgaattttcggtac---acgatagtgaaatcgt--------atgaaacaagtttt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
18890580 |
aaaaccacaagccaatttcaacaatcaatggtttattcatggatttgaattttcggtacacgacgatagtgaaatcgtacgtattcatgaaacaagtttc |
18890679 |
T |
|
| Q |
207 |
tccatataaactttt |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
18890680 |
tccatataaactttt |
18890694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University