View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20202_low_23 (Length: 229)
Name: NF20202_low_23
Description: NF20202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20202_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 13 - 217
Target Start/End: Complemental strand, 45212096 - 45211888
Alignment:
| Q |
13 |
agcacagaccatcgaagttagcctcacacccatgaatctttgatgtaaaacagagatttatgtgaattggcccctcttgcctacatccacggaagcacct |
112 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45212096 |
agcacacaccatcgaagttagccacacacccatgaatctttgatgtaaaacagagattgatgtgaattggcacctcttgcctacatccacggaagcacct |
45211997 |
T |
 |
| Q |
113 |
taacaaatatattcatcatctcaaataaaattaaaa----gaatctatagccgagctcaatatgtatatcactctacaatactcctactcaaaagttgca |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45211996 |
taacaaatatattcatcacctcaaataaaattaaaagaatgaatctatagccgagctcaatatgtatatcactctacaatactcctactcaagagttgca |
45211897 |
T |
 |
| Q |
209 |
agaaatgat |
217 |
Q |
| |
|
||||||||| |
|
|
| T |
45211896 |
agaaatgat |
45211888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 145
Target Start/End: Complemental strand, 15679903 - 15679873
Alignment:
| Q |
115 |
acaaatatattcatcatctcaaataaaatta |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15679903 |
acaaatatattcatcatctcaaataaaatta |
15679873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University