View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20202_low_24 (Length: 208)
Name: NF20202_low_24
Description: NF20202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20202_low_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 4586337 - 4586544
Alignment:
| Q |
1 |
tattcaagtttgtattgattgtttggttcagcggtaattagcatttcatgtgcttaatgtagtttgttttaataaaattttgcccctnnnnnnnctatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
4586337 |
tattcaagtttgtattgattgtttggttcagcggtaattagcatttcatgtgcttaatgtagtttgttttaataaaattttgcctctaaaaaaactatca |
4586436 |
T |
 |
| Q |
101 |
aaagatgaatagtccagttgcttccttcgtacaagataaattattgatgctatgaatatggagattaatcttaccaaacataaggtatgatatagtcttt |
200 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||| |||||||||||||||| |||||||||| |||||| || |||||||||||||||| |
|
|
| T |
4586437 |
aaagatgaatagtccaattgcttcctttgtacaagataaattatttatgctatgaatatggatattaatcttatcaaacaaaatgtatgatatagtcttt |
4586536 |
T |
 |
| Q |
201 |
tcaatgat |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
4586537 |
tcaatgat |
4586544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University