View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20202_low_5 (Length: 438)
Name: NF20202_low_5
Description: NF20202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20202_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 1e-32; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 352 - 431
Target Start/End: Complemental strand, 28451263 - 28451184
Alignment:
| Q |
352 |
agtaagtatgcattagacttagcaaagcatcaagtggttcatgaaaaagtaaacacattgagacatgtttctatattctt |
431 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28451263 |
agtaagtatgcattagacttagcaaagcatcaagtggctcatgaaaaagtaaacacattgagacatgtttctattttctt |
28451184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 28451575 - 28451522
Alignment:
| Q |
1 |
attggtaaattgttgccaaagggctatactatgaagatggaagcacatacaact |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28451575 |
attggtaaattgttgccaaagggctatactatgaagatggaagcacatacaact |
28451522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 353
Target Start/End: Complemental strand, 12748986 - 12748922
Alignment:
| Q |
289 |
atcaacatgcttatgttggaaatgaatctaaaggaagttgagaagatgtaattgctaattgatag |
353 |
Q |
| |
|
||||||||||||||| | |||||||| ||| | |||| ||||||||| |||| ||||||||||| |
|
|
| T |
12748986 |
atcaacatgcttatgctagaaatgaagctagaagaagaagagaagatggaattactaattgatag |
12748922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University