View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20203_low_12 (Length: 237)
Name: NF20203_low_12
Description: NF20203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20203_low_12 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 32681464 - 32681682
Alignment:
| Q |
19 |
ttcaattcaactactgttccttcaatgggtaggaaaaggatgagtgtttggtttaaacagcttgtcaaagttgcttctacattcccacggtttgttttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32681464 |
ttcaattcaactactgttccttcaatgggtaggaaaaggatgagtgtttggtttaaacagcttgtcaaagttgcttctacattcccacggtttgttttgt |
32681563 |
T |
 |
| Q |
119 |
gattttggattgtgacttgcaagggaagagtgacaatagcttacttctctatcaagaaagagaagtaagcttcaaaatggagaattcttctacttgcttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32681564 |
gattttggattgtgacttgcaagggaagagtgacaatagcttacttctctatcaagaaagagaagtaagcttcaaaatggagaattcttctacttgcttt |
32681663 |
T |
 |
| Q |
219 |
accagtaccactattggcc |
237 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32681664 |
accagtaccactattggcc |
32681682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University