View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20204_high_18 (Length: 323)
Name: NF20204_high_18
Description: NF20204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20204_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 7 - 309
Target Start/End: Original strand, 36960838 - 36961140
Alignment:
| Q |
7 |
gaagagcaaatcatagagagtattccactctcacttgttctgagtagggtttgggatgctaggtggtgctatcctcatacttggttccacaactttcctg |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36960838 |
gaagagcaaatcatagagagtattcctctctcacttgttctgagtagggtttgggatgctaggtggtgctatcctcatacttggttccacaactttcctg |
36960937 |
T |
 |
| Q |
107 |
ttttgtttcttacttccacttattttaccattgattccacttgttgcaaaagaagcaaaagatgaagatagaagctcccttgacattgttaatctcgtct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36960938 |
ttttgtttcttacttccacttattttaccattgatgccacttgttgcaaaagaagcaaaagatgaagatagaagctcccttgacattgttaatctcgtct |
36961037 |
T |
 |
| Q |
207 |
ttcttgaaaacattggttcatggtggacacaacaacaagagaagagaagaaagtgaatcagaatcaaggtcaatataacagcaaaaactctgcagctagt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36961038 |
ttcttgaaaacattggttcatggtggacacaacaacaagagaagagaagaaagtgaatcagaatcaaggtcaatataacagcaaaaactctgcagctagt |
36961137 |
T |
 |
| Q |
307 |
gat |
309 |
Q |
| |
|
||| |
|
|
| T |
36961138 |
gat |
36961140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University