View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20204_high_31 (Length: 250)

Name: NF20204_high_31
Description: NF20204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20204_high_31
NF20204_high_31
[»] chr2 (2 HSPs)
chr2 (1-77)||(42896850-42896926)
chr2 (166-210)||(42896720-42896764)


Alignment Details
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 42896926 - 42896850
Alignment:
1 tctgtgtgtgtatattatgtccaaaagaacaatagtggaaaccagaaaggcaagaggaaccctactgtataagtctc 77  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
42896926 tctgtgtgtgtatattatgtccaaaagaacaatagtggaaaccagaaaggcaataggaaccctactgtataagtctc 42896850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 166 - 210
Target Start/End: Complemental strand, 42896764 - 42896720
Alignment:
166 aagtgaactcaaatttttggccataataaacttttgtgtataata 210  Q
    |||||||||||||||||||||||||||||| ||||||||||||||    
42896764 aagtgaactcaaatttttggccataataaaattttgtgtataata 42896720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University