View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20204_high_31 (Length: 250)
Name: NF20204_high_31
Description: NF20204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20204_high_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 42896926 - 42896850
Alignment:
| Q |
1 |
tctgtgtgtgtatattatgtccaaaagaacaatagtggaaaccagaaaggcaagaggaaccctactgtataagtctc |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42896926 |
tctgtgtgtgtatattatgtccaaaagaacaatagtggaaaccagaaaggcaataggaaccctactgtataagtctc |
42896850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 166 - 210
Target Start/End: Complemental strand, 42896764 - 42896720
Alignment:
| Q |
166 |
aagtgaactcaaatttttggccataataaacttttgtgtataata |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42896764 |
aagtgaactcaaatttttggccataataaaattttgtgtataata |
42896720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University