View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20204_high_35 (Length: 235)

Name: NF20204_high_35
Description: NF20204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20204_high_35
NF20204_high_35
[»] chr3 (2 HSPs)
chr3 (1-112)||(52592866-52592977)
chr3 (180-217)||(52592763-52592800)


Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 52592977 - 52592866
Alignment:
1 cccggatttgaataaatgataaccaaacagggaacaatccattatacaaataaattatgttcttatatgcttgaaatgctttgttttttatggttgaaat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||    
52592977 cccggatttgaataaatgataaccaaacagggaacaatccattatacaaataaattctgttcttacatgcttgaaatgctttgttttttatggttgaaat 52592878  T
101 tacactggtcac 112  Q
    ||||||||||||    
52592877 tacactggtcac 52592866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 180 - 217
Target Start/End: Complemental strand, 52592800 - 52592763
Alignment:
180 taatagcccaatatagtctataaactaatgccatcttt 217  Q
    ||||||||||||||||||||||||||||||||||||||    
52592800 taatagcccaatatagtctataaactaatgccatcttt 52592763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University