View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20204_low_25 (Length: 276)
Name: NF20204_low_25
Description: NF20204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20204_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 34843475 - 34843218
Alignment:
| Q |
1 |
cttagatgcatggaacaaagtttaggttcaggatgggcgcaggccgcagaaacaacagaacnnnnnnnnttatttgcaaggtaagttggaaatgttgtat |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
34843475 |
cttagatgcatggatcaaagtttaggttcaggatgggcgcaggccgcagaaacaacggaacaaaaaaaattatttgtaaggtaagttggaaatgttgtat |
34843376 |
T |
|
| Q |
101 |
ggaacagcacaaccactatgcaaacaaatcttcgtctcatttcaaggactttaattcctcttaacgattacaaccttacaaatatattttggaaaatcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34843375 |
ggaacagcacaaccactatgcaaacaaatcttcgtctcatttcaaggactttaattcctcttaacgattacaaccttacaaatatattttggaaaatcta |
34843276 |
T |
|
| Q |
201 |
tcacatgggagagttgttagtgtatggaaaaatgttgtttattcacccatggtttgct |
258 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34843275 |
tcacatgggagagttgttagcgtatggaaaaatgttgtttattcacccatggtttgct |
34843218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University