View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20204_low_28 (Length: 253)
Name: NF20204_low_28
Description: NF20204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20204_low_28 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 9 - 253
Target Start/End: Complemental strand, 9441067 - 9440823
Alignment:
| Q |
9 |
agcagagaagaatatccgaggcatgtgtcgtgcacaaaatcgcgtatggttttctcaaggttgtccaagcagaattgggatccttgcagttgtaatcctt |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9441067 |
agcagaaaagaatatccgaggcatgtgttgtgcacaaaattgcgtatggttttctcaaggttgtccaagcagaattggaatccttgcagttgtaatcctt |
9440968 |
T |
|
| Q |
109 |
ggactatacataatatcatatgctcctggaatcggaacagtgccgtgggttctaaactcggagatttatcctttaaggttcagaggaataggtggaggta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9440967 |
ggactatacataatatcatatgctcctggaatcggaacagtgccttgggttctaaactcggagatttatcctttaaggttcagaggaataggtggaggta |
9440868 |
T |
|
| Q |
209 |
tagcagcagtttgcaactggtgtgctaatttaattatgagtgagt |
253 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
9440867 |
tagcagcagttttcaactggtgtgctaatgtaattatgagtgagt |
9440823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 16 - 253
Target Start/End: Complemental strand, 9452286 - 9452049
Alignment:
| Q |
16 |
aagaatatccgaggcatgtgtcgtgcacaaaatcgcgtatggttttctcaaggttgtccaagcagaattgggatccttgcagttgtaatccttggactat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9452286 |
aagaatatccgaggcatgtgtcgtgcacaaaaacgtgtatggttttcccaaggttgtccaagcagaattggaatccttgcagttgtaatccttggactat |
9452187 |
T |
|
| Q |
116 |
acataatatcatatgctcctggaatcggaacagtgccgtgggttctaaactcggagatttatcctttaaggttcagaggaataggtggaggtatagcagc |
215 |
Q |
| |
|
|||| ||| |||||||||||||||| ||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
9452186 |
acatcatagcatatgctcctggaattggaacagtgccttgggttctaaactcggagatttatccattgcggttcagaggaataggtggaggtatagcagc |
9452087 |
T |
|
| Q |
216 |
agtttgcaactggtgtgctaatttaattatgagtgagt |
253 |
Q |
| |
|
||||| |||||||||||| ||| ||||| ||||||||| |
|
|
| T |
9452086 |
agttttcaactggtgtgccaatctaattgtgagtgagt |
9452049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University