View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20204_low_36 (Length: 238)
Name: NF20204_low_36
Description: NF20204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20204_low_36 |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 21536679 - 21536459
Alignment:
| Q |
18 |
ataaggactgctgatacgcacctcattcattacaactatgacagtcttgtcccagcagactggaagcgttttagataaagcatcaaagatgttctgtgct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21536679 |
ataaggactgctgatacgcacctcattcattacaactatgacagtcttgtcccagcggactggaagcgttttagataaagcatcaaagatgttctgtgct |
21536580 |
T |
 |
| Q |
118 |
tcgcttgtaacaccaaccccaatcctctcagcatctgcctctgcttgtctaatggcaagttcttctcttgcttggagatcactgagatcaacgtagaaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21536579 |
tcgcttgtaacaccaaccccaatcctctcagcatctgcctctgcttgtctaatggcaagttcttctcttgcttggagatcattgagatcaacgtagaaat |
21536480 |
T |
 |
| Q |
218 |
tacgtggatcaagtgggtctt |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
21536479 |
tacgtggatcaagtgggtctt |
21536459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 84 - 168
Target Start/End: Original strand, 26482371 - 26482455
Alignment:
| Q |
84 |
cgttttagataaagcatcaaagatgttctgtgcttcgcttgtaacaccaaccccaatcctctcagcatctgcctctgcttgtcta |
168 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
26482371 |
cgttttagataatgcatcaaagatgttctgtgcttcacttgtaacaccaaccccaatcctctcagcatctgcttcagcttgtcta |
26482455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 84
Target Start/End: Original strand, 26480244 - 26480310
Alignment:
| Q |
18 |
ataaggactgctgatacgcacctcattcattacaactatgacagtcttgtcccagcagactggaagc |
84 |
Q |
| |
|
|||||||||||||| |||||||||||||| || |||||||| ||||||||||||| |||||||||| |
|
|
| T |
26480244 |
ataaggactgctgacgcgcacctcattcatcacgactatgacggtcttgtcccagcggactggaagc |
26480310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University