View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20204_low_37 (Length: 235)
Name: NF20204_low_37
Description: NF20204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20204_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 52592977 - 52592866
Alignment:
| Q |
1 |
cccggatttgaataaatgataaccaaacagggaacaatccattatacaaataaattatgttcttatatgcttgaaatgctttgttttttatggttgaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52592977 |
cccggatttgaataaatgataaccaaacagggaacaatccattatacaaataaattctgttcttacatgcttgaaatgctttgttttttatggttgaaat |
52592878 |
T |
 |
| Q |
101 |
tacactggtcac |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
52592877 |
tacactggtcac |
52592866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 180 - 217
Target Start/End: Complemental strand, 52592800 - 52592763
Alignment:
| Q |
180 |
taatagcccaatatagtctataaactaatgccatcttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52592800 |
taatagcccaatatagtctataaactaatgccatcttt |
52592763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University