View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20206_low_2 (Length: 399)
Name: NF20206_low_2
Description: NF20206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20206_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 142 - 379
Target Start/End: Original strand, 8208573 - 8208810
Alignment:
| Q |
142 |
gttaaccggatagaatgattttttgtcaaaagcaagtgagtctaaattgctgacttactctcaattatttttagacaggtatatatattaatagctctta |
241 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8208573 |
gttaacgggatagaatgattttttgtcaaaagcaagtgagtctgaattgctaacttactctcaattatttttagacaggtatatatattaatagctctta |
8208672 |
T |
|
| Q |
242 |
tatataatctaaagcatgcatcgcatgtgatactcatcatgtatagaggaatttgaaatactagtcacacgattcaattaatacaaccttttaattacaa |
341 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8208673 |
tatataatctaaagcatgaatcgcatgtgatactcatcatttatagaggaatttgaaagactagtcacacgattcaattaatacaaccttttaattacaa |
8208772 |
T |
|
| Q |
342 |
atcaatttataaaagaggaagtaaaaatttgatgaacc |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8208773 |
atcaatttataaaagaggaagtaaaaatttgatgaacc |
8208810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University