View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20207_high_3 (Length: 307)
Name: NF20207_high_3
Description: NF20207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20207_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 84 - 298
Target Start/End: Original strand, 41535351 - 41535560
Alignment:
| Q |
84 |
gtcagcaggtacgggaagaagaaagcaatgggatgacgatctgttgaccatgacctcagtaactttgtctttcagcggagagcaaagagtctaaactaaa |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41535351 |
gtcagcaggtacgggaagaagaaagcaatgggatgacgatctgttgaccatgacctcggtaactttgtctttcagcggagagcaaagagtctaa-----a |
41535445 |
T |
 |
| Q |
184 |
ctctcgaaactcgcattgcttaaacctccgttggataagtgtttgccaaaccaataccgcttcgcaaagcatggtggttgtggaaattctaaagctagta |
283 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41535446 |
ctctcgaaactggcattgcttaaacctccgttggataagtgtttgccaaaccaataccgcttcgcaaagcatggtggttgtggaaattctgaagctagta |
41535545 |
T |
 |
| Q |
284 |
tatcaagcttctgtg |
298 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41535546 |
tatcaagcttctgtg |
41535560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 59
Target Start/End: Original strand, 41535287 - 41535323
Alignment:
| Q |
23 |
tacaggaactaaaggaatggagtatcatttttctttt |
59 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41535287 |
tacaagaactaaaggaatggagtatcatttttctttt |
41535323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 214 - 296
Target Start/End: Complemental strand, 26135617 - 26135535
Alignment:
| Q |
214 |
ttggataagtgtttgccaaaccaataccgcttcgcaaagcatggtggttgtggaaattctaaagctagtatatcaagcttctg |
296 |
Q |
| |
|
||||||||| ||||||||| | |||||||| || ||| ||| ||| | ||| |||||| |||||||||||||||||||||| |
|
|
| T |
26135617 |
ttggataagcgtttgccaatctaataccgcgtcccaatgcacggttgccgtgaaaattcagaagctagtatatcaagcttctg |
26135535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University