View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20208_high_10 (Length: 316)
Name: NF20208_high_10
Description: NF20208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20208_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 95 - 303
Target Start/End: Original strand, 42450200 - 42450406
Alignment:
| Q |
95 |
tgttccaaatcagtcaactaggcgtgttcaagtttgatggtttagcaattgagcttatgaatttcatattaaaaattaggtaatatgtggaaagattgac |
194 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42450200 |
tgttccaaatcagttaactaggcgtgttcaagtttgatggtttagcaattgagcttatgaatttcatattaaaaattaggtaatatgtggaaagattgac |
42450299 |
T |
 |
| Q |
195 |
atgtttttctttaatatattggaagcgaaacacatatttttctttcagtcttgtttctgaaacatgcacagatacagttgccatatgtgattagccttac |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42450300 |
atgtttttctttaatatattggaagcgaaacacatatttttc--tcagtcttgtttctgaaacatgcacagacacagttgccatatgtgattagccttac |
42450397 |
T |
 |
| Q |
295 |
tccctttgc |
303 |
Q |
| |
|
||||||||| |
|
|
| T |
42450398 |
tccctttgc |
42450406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 52
Target Start/End: Original strand, 42450123 - 42450157
Alignment:
| Q |
18 |
atatgttcgaacttcataacactctgtatgaattg |
52 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42450123 |
atatgttcgaacttcattacactctgtatgaattg |
42450157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 128 - 164
Target Start/End: Original strand, 42263426 - 42263463
Alignment:
| Q |
128 |
ttgatggtttagcaattgagcttatg-aatttcatatt |
164 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42263426 |
ttgatggtttagcaattgagcttatgaaatttcatatt |
42263463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University