View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20209_high_19 (Length: 241)
Name: NF20209_high_19
Description: NF20209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20209_high_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 17987295 - 17987510
Alignment:
| Q |
19 |
attggtgaccatgacttcccggaatattggccttcactcctccctgaactcatctcgaaccttcagaaatcatcgcagacttcggattacgtctccatta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
17987295 |
attggtgaccatgacttcccggaatattggccttcactcctccctgaactcatctcaaaccttcacaaatcatcgcaggcttcggattatgtctccatta |
17987394 |
T |
|
| Q |
119 |
acggtattctcaccactgttaattaaattttcaggaaattttgtgttaattgtaaaaccaatgatctcttgcatgatttgaaatattgtattaataattt |
218 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| || ||||||| |
|
|
| T |
17987395 |
acggtattctcaccactgttaattcaattttcaggaaattttgtgttaattgtaaaaccaattatctcttggatgatttgaaatattgtcttgataattt |
17987494 |
T |
|
| Q |
219 |
cgcggctcctttgctt |
234 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
17987495 |
cgcggctcctttgctt |
17987510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University