View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20209_low_25 (Length: 209)
Name: NF20209_low_25
Description: NF20209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20209_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 30 - 196
Target Start/End: Original strand, 37718570 - 37718741
Alignment:
| Q |
30 |
gtgagggttcttttattccccttcttgctttataataattcgtttgacgacttcattattc-----catcattgcacaattaagaataagatgtatgaaa |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37718570 |
gtgagggttcttttattccccttcttgctttataataattcgtttgacgacctcattattcacttccatcattgcacaattaagaataagatgtatgaaa |
37718669 |
T |
 |
| Q |
125 |
attttaaatagaaaagatattagatgtctagtttaatacggatgtttaaagaatcaaacattttatgatttc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37718670 |
attttaaatagaaaagatattagatgtctagtttaatacggatgtttaaagaatcaaacattttatgatttc |
37718741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University