View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20211_high_1 (Length: 563)
Name: NF20211_high_1
Description: NF20211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20211_high_1 |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0011 (Bit Score: 488; Significance: 0; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 488; E-Value: 0
Query Start/End: Original strand, 21 - 556
Target Start/End: Original strand, 242833 - 243368
Alignment:
| Q |
21 |
tctgaggctgggaaattgttggaagagagagatgggaaagatgatgaagaaagtgcaaagaagaatgagaataggatttgaaatgattgttgatctgata |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
242833 |
tctgaggctgggaaattgttggaagagagagatgggaaagatgatgaagaaagtacaaagaagaatgagaataggatttgaaatgattgttgacctgata |
242932 |
T |
 |
| Q |
121 |
tttggatactgaaattattcttatttacattattatgcatgtttgttggtatagtccatgtttggggctgatactatactgatgttatgtcccttttaaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
242933 |
tttggatactgaaattattcttatttacattattatgcatgtttgttggtatagtccatgtttggggctgatactatactgatgttatgtcccttttaaa |
243032 |
T |
 |
| Q |
221 |
ttttattgagtttatgaatagagaatgaattaggcattatggatatttaccaaacaaattgtatgttcaaacaatcttatggatgatgattgatgagcat |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
243033 |
ttttattgagtttatgaatagagaatgaattaggcattatggatatttaccaaacaaattgtatggtcaaacaatcttatggatgatgattgatgagcat |
243132 |
T |
 |
| Q |
321 |
aattcgtggttgctatcttcatattcttgttagctgatttattttttagtttctctagttgtagtttaagttgtggctttacaattacaaccctaattat |
420 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
243133 |
aattcgtggttgctatcttcatattcttgttagttactttattttttagtttctctagttgtagtttaagttgtggctttacaattacaactctaattgt |
243232 |
T |
 |
| Q |
421 |
gaccgcaagcactttcaacattcgaaaaacatgttgcgtgtttagctcaaatggtaaaatgttgcattgacacattatatactggggcgtgaatttcaat |
520 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
243233 |
gaccgcaagcactttcaacaatcgaaaaacatgttgcgtgtttagctcaaatggtaaaatgttgcattgacacattatatactggagcgtgaatttcaat |
243332 |
T |
 |
| Q |
521 |
ctgcaattttctactttcgtactctagtctgtgctg |
556 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
243333 |
atgcaattttctactttcgtactctagtgtgtgctg |
243368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University