View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20212_high_8 (Length: 245)
Name: NF20212_high_8
Description: NF20212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20212_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 157 - 230
Target Start/End: Complemental strand, 52465393 - 52465320
Alignment:
| Q |
157 |
gtctttgtacgattccgtttatctttatatgttgatagtaaaagatagaataatgatatttgtatcgacatttt |
230 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52465393 |
gtctttgcacgattccgtttatctttatatgttgatagtaaaagatagaataatgatatttgtatcgacatttt |
52465320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 52465527 - 52465468
Alignment:
| Q |
19 |
gatctattgaacagggatgattttggatcaaaattgaccctaaatcattcatcgaaattg |
78 |
Q |
| |
|
||||||||| | |||||||||||||| ||||||||||||||||||||| |||| |||||| |
|
|
| T |
52465527 |
gatctattgcatagggatgattttgggtcaaaattgaccctaaatcatccatccaaattg |
52465468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 31 - 67
Target Start/End: Original strand, 11824936 - 11824972
Alignment:
| Q |
31 |
agggatgattttggatcaaaattgaccctaaatcatt |
67 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11824936 |
agggatgattttggatcaaaattgaccttaaatcatt |
11824972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 65
Target Start/End: Complemental strand, 25961942 - 25961910
Alignment:
| Q |
33 |
ggatgattttggatcaaaattgaccctaaatca |
65 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
25961942 |
ggatgattctggatcaaaattgaccctaaatca |
25961910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 32 - 65
Target Start/End: Complemental strand, 8937648 - 8937615
Alignment:
| Q |
32 |
gggatgattttggatcaaaattgaccctaaatca |
65 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
8937648 |
gggatgattttgggtcaaaattgaccctaaatca |
8937615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University