View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20212_low_15 (Length: 218)
Name: NF20212_low_15
Description: NF20212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20212_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 137 - 199
Target Start/End: Complemental strand, 36847005 - 36846943
Alignment:
| Q |
137 |
atatcaatgtcatgatgtttttgattaagatcacttgtatgatcatgttggtgtgcttacctc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36847005 |
atatcaatgtcatgatgtttttgattaagatcacttgtatgatcatgttggtgtgcttacctc |
36846943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University