View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20212_low_16 (Length: 213)
Name: NF20212_low_16
Description: NF20212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20212_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 40068284 - 40068482
Alignment:
| Q |
1 |
cacaaagatgctccgtggagaatgaagctgttgatgaagtttatatttgtttgactctagctggtgtaatggtttcaggattcataactgatttcatagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40068284 |
cacaaagatgctccgtggagaatgaagctgttgatgaagtttatatttgtttgactctagctggtgtaatggtttcaggattcataactgatttcatagg |
40068383 |
T |
|
| Q |
101 |
gattcatgcgatttttggggcgtttgtttttggattaactattccaaagacaggtagttttgctgagaggttgatagagagaatagaggattttgtttt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40068384 |
gattcatgcgatttttggggcgtttgtttttggattaactattccaaagacaggtagttttgctgagaggttgatagagagaatagaggattttgtttt |
40068482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 3 - 196
Target Start/End: Original strand, 40026037 - 40026230
Alignment:
| Q |
3 |
caaagatgctccgtggagaatgaagctgttgatgaagtttatatttgtttgactctagctggtgtaatggtttcaggattcataactgatttcataggga |
102 |
Q |
| |
|
||||||||||| ||||| |||||||| || | ||||||||||||| ||| || ||||| ||||||||||| ||||||||||||| ||||||||| |||| |
|
|
| T |
40026037 |
caaagatgctcagtggaaaatgaagccgtaaacgaagtttatatttctttaaccctagcgggtgtaatggtgtcaggattcataattgatttcattggga |
40026136 |
T |
|
| Q |
103 |
ttcatgcgatttttggggcgtttgtttttggattaactattccaaagacaggtagttttgctgagaggttgatagagagaatagaggattttgt |
196 |
Q |
| |
|
| |||||||||||||| ||||||||||||||||| || |||||||| | |||| |||| | ||| ||||||||||||||| ||||||||||| |
|
|
| T |
40026137 |
tccatgcgatttttggtgcgtttgtttttggattgacaattccaaaaaatggtaatttttcgaagaagttgatagagagaattgaggattttgt |
40026230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 48 - 139
Target Start/End: Original strand, 40080633 - 40080724
Alignment:
| Q |
48 |
tgtttgactctagctggtgtaatggtttcaggattcataactgatttcatagggattcatgcgatttttggggcgtttgtttttggattaac |
139 |
Q |
| |
|
|||||||| ||||||||||| ||| | ||||||||||| || ||||| ||||| || ||| |||||||||| || ||||||||||| ||||| |
|
|
| T |
40080633 |
tgtttgacactagctggtgttatgttgtcaggattcatgacggatttgataggaatacattcgatttttggtgcatttgtttttgggttaac |
40080724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University