View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20212_low_3 (Length: 385)
Name: NF20212_low_3
Description: NF20212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20212_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 1 - 347
Target Start/End: Original strand, 32305234 - 32305581
Alignment:
| Q |
1 |
ctagccaggttcaatatattctaatattcatcattttttaatttcaaacctccaaacaataattctacatatacttggttaatataagtattatgttcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32305234 |
ctagccaggttcaatatattctaatattcattattttttaatttcaaacctccaaacaataattctacatatacttggttaatataagtattgtgttcta |
32305333 |
T |
 |
| Q |
101 |
tataggcttgtctttagataaagattgataagtactactttcaatcttttatgcagggagttgaagctcaccaacttcagcaatggtttggttaaaaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32305334 |
tataggcttgtctttagataaagattgataagtactactttcaatcttttatgcagggagttgaagctcaccaacttcagcaatggtttggttaaaaaac |
32305433 |
T |
 |
| Q |
201 |
gcagcagcagattctttgcaacggttggtggaagaaggtaataactctcattaaagctctttactattggtattactcatgctgctgtctt-ccatatta |
299 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32305434 |
gcagcagcagattctatgcaacggttggtggaagaaggtactaactctcattaaagctctttactattggtattactcatgctgctgtcttcccatatta |
32305533 |
T |
 |
| Q |
300 |
tgtgcaattatagtagtctctgaattcttcataaatgaattgcactta |
347 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32305534 |
tgtgcaattatagtagtatctgaattcttcataaatgaattgcactta |
32305581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University