View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20213_high_4 (Length: 369)
Name: NF20213_high_4
Description: NF20213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20213_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 15 - 320
Target Start/End: Original strand, 401764 - 402069
Alignment:
| Q |
15 |
ggacatcatagccctctcccattccagcacaacagccacatcccatagccataggcgctatattggcaagacttcagaggtttgttccacctgaaagggt |
114 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
401764 |
ggacatcacagccctctcccattccagcacaacagccacatcccatagccataggcgctatattggcaagacttcagaggtttgttccatctgaaagggt |
401863 |
T |
|
| Q |
115 |
tcgaagattgagacctataatgtttcgttgaatgaaatctccgaaaaccagcaaatatttattctggcatctcataaatacaatctcgattttattccca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
401864 |
tcgaagattgagacctataatgtttcgttgaatgaaatctccgaaaaccagcaaatatttattctggcatctcataaatacaatctcgattttatccaca |
401963 |
T |
|
| Q |
215 |
gttaaaccagccggcttcaagcaattgagagagnnnnnnnnggtcttccaacacccttcaaacacagaaaccaattgtttgggttagcagcctcccagca |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401964 |
gttaaaccagccggcttcaagcaattgagagagttttttttggtcttccaacacccttcaaacacagaaaccaattgtttgggttagcagcctcccagca |
402063 |
T |
|
| Q |
315 |
caccat |
320 |
Q |
| |
|
|||||| |
|
|
| T |
402064 |
caccat |
402069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University