View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20213_high_9 (Length: 288)
Name: NF20213_high_9
Description: NF20213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20213_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 38050625 - 38050879
Alignment:
| Q |
1 |
atcgtcacccattccgtgagaggatgagtatgtcaacatatgattcatctcacccttctcaaattggtcaaaatagttgcgtattatgttgtcaagattt |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38050625 |
atcgtcacccatttcgtgagaggatgagtatgtcaacatatgattcatctcacccttctgaaattggtcaaaatagttgcgtattatgttgtcaagattt |
38050724 |
T |
|
| Q |
101 |
tgcaaacacacaaacaacattagtcctatatttcatgtttaactatatttcatgtttaacaacatataagtgagagaactcatacacataatatcgtact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38050725 |
tgcaaacacacaaacaacattagtcctatatt-----------------tcatgtttaacaacatataagtgagagaactcatacatataatatcgtact |
38050807 |
T |
|
| Q |
201 |
gttttagatgaagattcgataattcaaactcacttgtataatcctgttttctctacaatggatttaacaaca |
272 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38050808 |
gttttagatgaagattcggtaattcaaactcacttgtataatcctgttttctctacaatggatttaacaaca |
38050879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University