View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20214_low_20 (Length: 256)
Name: NF20214_low_20
Description: NF20214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20214_low_20 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 16 - 256
Target Start/End: Complemental strand, 5107750 - 5107510
Alignment:
| Q |
16 |
atggaacaaaacatcgaaacaatggaaacgaggtttgatcttttacatggatcaatcacaacagcatcaagaagagtacaccctttacaatccttatcca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5107750 |
atggaacaaaacatcgaaacaatggaaacgaggtttgatcttttacatggatcaatcacaacagcatcaagaagagtacaccctttacaatccttatcca |
5107651 |
T |
 |
| Q |
116 |
tgtcaagaaaagcacttgatacaagaatcaatagagcaatttctcctgctcttgcacttctcgaaactttcaaactcgctgagtctctccagaacaatct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5107650 |
tgtcaagaaaagcacttgatacaagaatcaatagagcaatttctcctgctcttgcacttctcgaaactttcaaactcgctgagtctctccagaacaatct |
5107551 |
T |
 |
| Q |
216 |
ccttaacctctcttcaaagctatcaacagaaaagactcatc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5107550 |
ccttaacctctcttcaaagctatcaacagaaaagactcatc |
5107510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University