View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20214_low_22 (Length: 247)
Name: NF20214_low_22
Description: NF20214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20214_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 5107495 - 5107260
Alignment:
| Q |
1 |
aagcttctagattacatggattgtgttgatcagttaaatgaagctattaactctataagtgaagttgttgagccagtgattatgaggcttcaagaagttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5107495 |
aagcttctagattacatggattgtgttgatcagttaaatgaagctattaactctataagtgaagttgttgagccagtgattatgaggcttcaagaagttg |
5107396 |
T |
 |
| Q |
101 |
tggagtttataagcagaacaaaagctgctgatcaatacagaacacaaaggttaagagaagcacttataactcttaaggcactttatgaaactgaggttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5107395 |
tggagtttataagcagaacaaaagctgctgatcaatacagaacacaaaggttaagagaagcacttataactcttaaggcactttatgaaactgaggttga |
5107296 |
T |
 |
| Q |
201 |
tgaaatgagatttgaaggtttgttggatcaagcttt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
5107295 |
tgaaatgagatttgaaggtttgttggatcaagcttt |
5107260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University