View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20214_low_26 (Length: 214)
Name: NF20214_low_26
Description: NF20214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20214_low_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 203
Target Start/End: Complemental strand, 16735926 - 16735888
Alignment:
| Q |
165 |
ctattgcaatatacttctgcattcataagatttgttgat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16735926 |
ctattgcaatatacttctgcattcataagatttgttgat |
16735888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 68 - 125
Target Start/End: Original strand, 30515632 - 30515689
Alignment:
| Q |
68 |
tcttttgcttcaacctgtggcaatttttgaatcattttgttcatggttgaattaaaca |
125 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||| |||| |||||||| ||||||||| |
|
|
| T |
30515632 |
tcttttgcttcaaactgtgacaatttttgaatccttttcttcatggtaaaattaaaca |
30515689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University