View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20214_low_26 (Length: 214)

Name: NF20214_low_26
Description: NF20214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20214_low_26
NF20214_low_26
[»] chr6 (1 HSPs)
chr6 (165-203)||(16735888-16735926)
[»] chr2 (1 HSPs)
chr2 (68-125)||(30515632-30515689)


Alignment Details
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 203
Target Start/End: Complemental strand, 16735926 - 16735888
Alignment:
165 ctattgcaatatacttctgcattcataagatttgttgat 203  Q
    |||||||||||||||||||||||||||||||||||||||    
16735926 ctattgcaatatacttctgcattcataagatttgttgat 16735888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 68 - 125
Target Start/End: Original strand, 30515632 - 30515689
Alignment:
68 tcttttgcttcaacctgtggcaatttttgaatcattttgttcatggttgaattaaaca 125  Q
    ||||||||||||| ||||| ||||||||||||| |||| ||||||||  |||||||||    
30515632 tcttttgcttcaaactgtgacaatttttgaatccttttcttcatggtaaaattaaaca 30515689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University