View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20215_low_11 (Length: 240)
Name: NF20215_low_11
Description: NF20215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20215_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 3 - 155
Target Start/End: Original strand, 23097203 - 23097355
Alignment:
| Q |
3 |
caccctttaataaaagttaccaagttagccaataatttttgaatttgaaaatagtaactatggttgtgaatatcataatggatatggcaaacaaatcatt |
102 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |||| |||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
23097203 |
caccctttaataaaagttactaagttagccaataatttttgaatttgagaatagtggctattgttgtgaatatcataaaggatatggcaaacgaatcatt |
23097302 |
T |
|
| Q |
103 |
aaatgatggtgttaataaatcatcacttgcattagaaagagaagcacacaaaa |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
23097303 |
aaatgatggtgttaataaatcatcacttgcattggaaagagaaacacacaaaa |
23097355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 212
Target Start/End: Original strand, 23097551 - 23097581
Alignment:
| Q |
182 |
gccaacgctaccaatgacatgggaatgttgt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23097551 |
gccaacgctaccaatgacatgggaatgttgt |
23097581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University