View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20216_high_10 (Length: 270)

Name: NF20216_high_10
Description: NF20216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20216_high_10
NF20216_high_10
[»] chr6 (1 HSPs)
chr6 (170-258)||(10071722-10071812)


Alignment Details
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 170 - 258
Target Start/End: Complemental strand, 10071812 - 10071722
Alignment:
170 tacatgcctatgcagccttttacgagtttggtagagttcattcttaacatctatattttcaagttgtt--atgatttagttgagttcttct 258  Q
    ||||||| |||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||||||  |||||||||||| ||||||||    
10071812 tacatgcttatggagccttttacaagtttggcagagttcattcttaacatctatattttcaagttgttccatgatttagttgtgttcttct 10071722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University