View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20216_high_13 (Length: 231)
Name: NF20216_high_13
Description: NF20216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20216_high_13 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 1231530 - 1231300
Alignment:
| Q |
1 |
aaatcatgtagattcctctagtttttcttaataaagcatatcgcgaagcaagaagtgacaatcctgcatgtactgaatgggaagagcaaggtttgttcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1231530 |
aaatcatgtagattcctctagtttttctcaataaagcatatcacgaagcaagaagtgacaatcctgcatgtactgaatgggaagagcaagatttgttcca |
1231431 |
T |
|
| Q |
101 |
ctccacatggattttgtcaatgatcttctcttctcttttgttgtgattcattcgtcttcacaattctttgcagctttggggtgaaattcacagttatagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1231430 |
ctccacatggattttgtcaatgatcttctcttctcttttgttgtgattcattcgtcttcacaattcttggcagctttggggtgaaattcacagttatagc |
1231331 |
T |
|
| Q |
201 |
tttacgcaaatgtgaactcgttttgaaaact |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1231330 |
tttacgcaaatgtgaactcgttttgaaaact |
1231300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University