View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20216_low_11 (Length: 333)
Name: NF20216_low_11
Description: NF20216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20216_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 3 - 312
Target Start/End: Original strand, 8878509 - 8878818
Alignment:
| Q |
3 |
tgggtagatgaggatagaagagtgttccatcaattatggaaaagtccggcgccctctaaggtgattgcgttttcgtggaagatgttgcttgataggattc |
102 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8878509 |
tggggagatgaggatagaagagtgttccatcaattatggaaaagtccggcgccctctaaggtgattgcgttctcgtggaagatgttgcttgataggattc |
8878608 |
T |
 |
| Q |
103 |
ctactcggaccaatcttagtagaaggaatgctcttccaccggaggttcctttgaattgtgtttggtgcgttggggagagggagatgacgaagcatcnnnn |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8878609 |
ctactcggaccaatcttagtagaaggaatgctcttccaccggaggttcctttgaattgtgtttggcgcgttggggagagggagatgacgaagcatctttt |
8878708 |
T |
 |
| Q |
203 |
nnngcattgtagtcttgcaagggatgtttggttacggcttatgcattgggttgatattatgtttataatgccaaacaatttgttcacgcactgggcttgt |
302 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8878709 |
tttgcattgtagtcttgcaaggggtgtttggttacggcttatgcattgggttgatattatgtttataatgccaaacaatttgttcacacactgggcttgt |
8878808 |
T |
 |
| Q |
303 |
tggaatgccg |
312 |
Q |
| |
|
|||||||||| |
|
|
| T |
8878809 |
tggaatgccg |
8878818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University