View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20216_low_12 (Length: 333)
Name: NF20216_low_12
Description: NF20216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20216_low_12 |
 |  |
|
| [»] scaffold0047 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 323
Target Start/End: Complemental strand, 30169461 - 30169149
Alignment:
| Q |
1 |
ctacttctgtgcaggtcattctgattctgtatctagtttagcttttagctatgatgggaagtttcttgcatctggaagcatggatggaattgttcaagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30169461 |
ctacttctgtgcaggtcattctgattctgtatctagtttagcttttagctatgatgggaagtttcttgcatctggaagcatggatggaattgttcaagtt |
30169362 |
T |
 |
| Q |
101 |
tgggatgtatatggaaatttgagtagtgtgcttaatggtcctaatggtggcattgaggtaaaatgagattcttaactttcccatgaaatctttcactttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30169361 |
tgggatgtatatggaaatttgagtagtgtgcttaatggtcctaatggtggcattgaggtaaaatgagattcttaactttcccatgaaatctttcactt-- |
30169264 |
T |
 |
| Q |
201 |
agtggctcagatggaatccgagagatggtggtagtgtgacctgcggtgatttcacccctgatggtactaatttctctcttcatattttcttgatgcatct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30169263 |
------tcagatggaatccgagagatggtggtagtgtgacctgcggtgatttcacccctcatggtactaatt--tctcttcatattttcttgatgcatct |
30169172 |
T |
 |
| Q |
301 |
tcctttatctattattatctgtg |
323 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30169171 |
tcctttatctattattatctgtg |
30169149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 29 - 114
Target Start/End: Complemental strand, 27744386 - 27744301
Alignment:
| Q |
29 |
gtatctagtttagcttttagctatgatgggaagtttcttgcatctggaagcatggatggaattgttcaagtttgggatgtatatgg |
114 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||| |||||||| ||| | ||||| |||| | ||||||||||| |
|
|
| T |
27744386 |
gtatctagtttagcttttagctacgatggacagtttcttgcatcaggaagcatcgatagggttgtttaagtctaagatgtatatgg |
27744301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 181 - 213
Target Start/End: Complemental strand, 27744204 - 27744172
Alignment:
| Q |
181 |
ccatgaaatctttcactttcagtggctcagatg |
213 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
27744204 |
ccatgaactctttcactttcagtggctcagatg |
27744172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: scaffold0047
Description:
Target: scaffold0047; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 225 - 312
Target Start/End: Complemental strand, 56114 - 56028
Alignment:
| Q |
225 |
atggtggtagtgtgacctgcggtgatttcacccctgatggtactaatttctctcttcatattttct---tgatgcatcttcctttatctat |
312 |
Q |
| |
|
|||||| ||||||||||| |||||||||| |||||||||||||||| || ||||||||||||| || ||||||||||||||||||| |
|
|
| T |
56114 |
atggtgttagtgtgacctctggtgatttca-ccctgatggtactaat---tcccttcatattttcttcgtgttgcatcttcctttatctat |
56028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 135 - 179
Target Start/End: Complemental strand, 56318 - 56274
Alignment:
| Q |
135 |
atggtcctaatggtggcattgaggtaaaatgagattcttaacttt |
179 |
Q |
| |
|
|||||||||| |||| ||| |||||||| |||||||||||||||| |
|
|
| T |
56318 |
atggtcctaaaggtgccatagaggtaaagtgagattcttaacttt |
56274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University