View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20216_low_15 (Length: 270)
Name: NF20216_low_15
Description: NF20216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20216_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 170 - 258
Target Start/End: Complemental strand, 10071812 - 10071722
Alignment:
| Q |
170 |
tacatgcctatgcagccttttacgagtttggtagagttcattcttaacatctatattttcaagttgtt--atgatttagttgagttcttct |
258 |
Q |
| |
|
||||||| |||| |||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
10071812 |
tacatgcttatggagccttttacaagtttggcagagttcattcttaacatctatattttcaagttgttccatgatttagttgtgttcttct |
10071722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University