View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20216_low_22 (Length: 202)
Name: NF20216_low_22
Description: NF20216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20216_low_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 27 - 187
Target Start/End: Complemental strand, 33420165 - 33420005
Alignment:
| Q |
27 |
tttttatgtggaaattctttgagttaattttactttattaagttgaaaattgaggttttgataattgaaatttggactatggtaatagattatgttacaa |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33420165 |
tttttatgtggaaattctttgagttaattttactttattaagttgaaaattgaagttttgttaattgaaatttggactatggtaatagattatgttacaa |
33420066 |
T |
|
| Q |
127 |
agcatgaatttttatgaaggttggttgaaattttaactccttaatgcattcttgttacact |
187 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33420065 |
agcatgaatttttattaagcttggttgaaattttaactccttaatgcattcttgttacact |
33420005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 70 - 187
Target Start/End: Complemental strand, 33406608 - 33406491
Alignment:
| Q |
70 |
tgaaaattgaggttttgataattgaaatttggactatggtaatagattatgttacaaagcatgaatttttatgaaggttggttgaaattttaactcctta |
169 |
Q |
| |
|
|||||||||| ||||| |||||||| ||||||||| ||||||||||||||||||||| ||||||||||||| ||| ||||||||||||| | || ||| |
|
|
| T |
33406608 |
tgaaaattgattttttgttaattgaagtttggactaaggtaatagattatgttacaaaacatgaatttttattaagcttggttgaaatttcatcttatta |
33406509 |
T |
|
| Q |
170 |
atgcattcttgttacact |
187 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
33406508 |
attcattcttgttacact |
33406491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University