View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20217_high_7 (Length: 253)
Name: NF20217_high_7
Description: NF20217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20217_high_7 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 253
Target Start/End: Complemental strand, 39519857 - 39519624
Alignment:
| Q |
18 |
caaatcttagagtttgggttggatataactcaacgtttacaaaactggcttgtaacgtgaagaatgtcttccacttattggcatattttcatgttatatc |
117 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39519857 |
caaatcatagagtttgggttggatataactcaacgtttataaaactggcttgtaacgtgaagaatgtcttccacttattggcatattttcatgttatatc |
39519758 |
T |
 |
| Q |
118 |
tcatcgaatgtgggattttgaacacacctcatatccaagactaaacatttgttgcgcaacccaagtgatcagatagcgcggacggtctaacgaatcttcg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||| |||||| |||||||||||||||| |
|
|
| T |
39519757 |
tcatcgaatgtgggattttgaacacacctcatatccaagactaaacatttgttgcgcgacccagatgatctgata--gcggacagtctaacgaatcttcg |
39519660 |
T |
 |
| Q |
218 |
atgagacttaataccatcttagaatttgagatgagt |
253 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||| |
|
|
| T |
39519659 |
atgaaacttaatatcatcttagaatttgagatgagt |
39519624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University