View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20217_high_8 (Length: 237)
Name: NF20217_high_8
Description: NF20217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20217_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 7174188 - 7174007
Alignment:
| Q |
1 |
gattattgtcccagcagcaatgtcatggaatgcaagagatgaccctggatttgtaattgccactttctgaaaaacaggaagagatgtgagcataagctat |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7174188 |
gattattgtccc---agcaatgtcatggaatgcaagagatgaccctggatttgtaattgccactttctgaaaaacaggaagagatgtgagcataagctat |
7174092 |
T |
 |
| Q |
101 |
tgttctcttgccatggaatctcatgttcttgtagtttatgtttctataatagttatgttttgtttggcctgtttaaaaggataat |
185 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7174091 |
tgttctcttgccagggaatctcatgttcttgtagtttatgtttctataatagttatgttttgtttggcctgttgaaaaggataat |
7174007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 15 - 221
Target Start/End: Complemental strand, 7174177 - 7173953
Alignment:
| Q |
15 |
cagcaatgtcatggaatgcaagagatgaccctggatttgtaattgccactttctgaaaaacaggaagagatgtgagcataagctattgttctcttgccat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7174177 |
cagcaatgtcatggaatgcaagagatgaccctggatttgtaattgccactttctgaaaaacaggaagagatgtgagcataagctattgttctcttgccag |
7174078 |
T |
 |
| Q |
115 |
ggaatctcatgttcttgtagtttatgtttctataatagttatgttttgtttggcctgtttaaaaggataat------------------ggattagagaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
7174077 |
ggaatctcatgttcttgtagtttatgtttctataatagttatgttttgtttggcctgttgaaaaggataattagtaaaaaggattgtatggattagagaa |
7173978 |
T |
 |
| Q |
197 |
tgcttagtaccacattatttaaatc |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
7173977 |
tgcttagtaccacattatttaaatc |
7173953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 15 - 184
Target Start/End: Original strand, 7152684 - 7152853
Alignment:
| Q |
15 |
cagcaatgtcatggaatgcaagagatgaccctggatttgtaattgccactttctgaaaaacaggaagagatgtgagcataagctattgttctcttgccat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7152684 |
cagcaatgtcatggaatgcaagagatgaccctggatttgtaattgccactttccgaaaaatgggaagagatgtgagcataagctattgttctcttgccag |
7152783 |
T |
 |
| Q |
115 |
ggaatctcatgttcttgtagtttatgtttctataatagttatgttttgtttggcctgtttaaaaggataa |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7152784 |
ggaatctcatgttcttgtagtttatgtttctataatagttatgttttgtttggcctgtttaaaaggataa |
7152853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University