View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20218_high_20 (Length: 248)

Name: NF20218_high_20
Description: NF20218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20218_high_20
NF20218_high_20
[»] chr1 (1 HSPs)
chr1 (76-232)||(4409124-4409280)


Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 76 - 232
Target Start/End: Complemental strand, 4409280 - 4409124
Alignment:
76 cattgatacagtgtatagtgtttggtgcagtgccactcatttctgtttcaggctttagagggcccatcttttcactctctctctgatcatttatctgaat 175  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4409280 cattgatacagtgtatagtgtttggtgcagtgccactcatttctgtttcaggctttagagggcccatcttttcactctctctctgatcatttatctgaat 4409181  T
176 cactgctatatttcactctctctctgttcatagcatagcaggtgcatacagaaagaa 232  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4409180 cactgctatatttcactctctctctgttcatagcatagcaggtgcatacagaaagaa 4409124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University