View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20218_low_10 (Length: 392)
Name: NF20218_low_10
Description: NF20218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20218_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 115 - 377
Target Start/End: Complemental strand, 36938816 - 36938554
Alignment:
| Q |
115 |
ttgttgtttcaacatacaaattaattttgtaaagat-agttagactcaatataaatatttaatattttttcttcaatagttttggtattgcattttggct |
213 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
36938816 |
ttgttgttt-aacatacaaactaattttgtaaagatgagttagactcaatataaatatttaatattttttctccaatagttttggtattgtattttggct |
36938718 |
T |
 |
| Q |
214 |
attaaatcattgtgctgccaataagaccctttggtaatattgtatctacttatatcgaacaatgaactttaccttttttcggatatatttcctccacacg |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
36938717 |
attaaatcattgtgctgccaataagaccctttggtaatattgtgtctacttatatcgaacaatgaactttatcttttttcgggtatatttcctccacacg |
36938618 |
T |
 |
| Q |
314 |
agataatcttatttggaacattgtcggatactaaatataaatacattttcaattgattctctat |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36938617 |
agataatcttatttggaacattgtcggatactaaatataaatagattttcaattgattctctat |
36938554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 36939017 - 36938908
Alignment:
| Q |
4 |
tataaatgcatactatgagatcagaacttatcgattcaggttgtccaccatttgtacttacgcatcaaacccatagtgttgaaaagagttttggtaaaga |
103 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36939017 |
tataaatgcatactatgagatcagagcttatcgattcaggttgtccaccatttgtacttacacatcaaacccatagtattgaaaagagttttggtaaaga |
36938918 |
T |
 |
| Q |
104 |
taaagataga |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
36938917 |
taaagataga |
36938908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University