View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20218_low_16 (Length: 298)
Name: NF20218_low_16
Description: NF20218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20218_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 13 - 282
Target Start/End: Original strand, 44112594 - 44112864
Alignment:
| Q |
13 |
atcatcatatcatatgattaat-ataagttgcaagaggaatgccactgaaagaagctttggagcgtagcaacatcagctctgtagtgtttttgtgtaaat |
111 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44112594 |
atcatcatatcatatgattaattataagttgcaagaggaatgccactgaaagaagctttggagcgtagcaacatcagctctgtagtgtttttgtgtaaat |
44112693 |
T |
 |
| Q |
112 |
tcaaacaaacttgaccatgtaaaatcagggtactttcttgcctcatttttgcttaacaaattttctgggggtctcaccactttgtcttctcttggacaca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44112694 |
tcaaacaaacttgaccatgtaaaatcagggtactttcttgcctcatttttgcttaacaaattttctgggggtctcaccactttgtcttctcttggacaca |
44112793 |
T |
 |
| Q |
212 |
caaagaaaaccagtgaccttctttctctgtatctgttcactaatgccctgtggaggcaactcttgtatctt |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44112794 |
caaagaaaaccagtgaccttctttctctgtatctgttcactaatgccctgtggaggcaactcttgtatctt |
44112864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University