View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20218_low_17 (Length: 297)
Name: NF20218_low_17
Description: NF20218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20218_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 33659447 - 33659242
Alignment:
| Q |
1 |
actggaggaatcttgtacggggtagtgaggatagagaaggtagttttgattacttttttctgtgttttggggcttataagctgcgcaagaatttttccta |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33659447 |
actggaggaattttgtacggggtagtgaggatagagaaggtagttttgattacttttttctgtgttttggggcttataagctgtgcaagaatttttccta |
33659348 |
T |
|
| Q |
101 |
aggggagcatcactctcattatgtgtttcttctactctgaatctttaacgaagaacatattattannnnnnntgctgtttctcatctgcattgagattgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33659347 |
aggggagcatcactctcattatgtgtttcttctactctgaatctttaacgaagaacatattattagggggggtgctgtttctcatctgcattgagattgg |
33659248 |
T |
|
| Q |
201 |
gatgcc |
206 |
Q |
| |
|
|||||| |
|
|
| T |
33659247 |
gatgcc |
33659242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University