View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20218_low_23 (Length: 249)
Name: NF20218_low_23
Description: NF20218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20218_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 20 - 136
Target Start/End: Original strand, 45051035 - 45051151
Alignment:
| Q |
20 |
agagagttaaatggtatgtgggttgggagaataagagtgaaaagaggattgtgcttggttaacagaggaaggaaggtgaaggggctggattgctgggtgg |
119 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
45051035 |
agagagttaaatggtatgtgggttgagagaataagagtgaaaagaggattgtgcttggttaacagaggaaggatggtgaaggggcttgattgctgggtgg |
45051134 |
T |
|
| Q |
120 |
gccacctaggaaaattc |
136 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45051135 |
gccacctaggaaaattc |
45051151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 79 - 122
Target Start/End: Complemental strand, 36753751 - 36753708
Alignment:
| Q |
79 |
taacagaggaaggaaggtgaaggggctggattgctgggtgggcc |
122 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36753751 |
taacaaaggaaggaaggtgaaggggctggattgctgggtgggcc |
36753708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 60 - 116
Target Start/End: Original strand, 15155576 - 15155632
Alignment:
| Q |
60 |
aaagaggattgtgcttggttaacagaggaaggaaggtgaaggggctggattgctggg |
116 |
Q |
| |
|
||||||||||||| ||| ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
15155576 |
aaagaggattgtgtttgcgtaacaaaggaaggaaggtgaaggggctggattgttggg |
15155632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University