View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20218_low_25 (Length: 240)
Name: NF20218_low_25
Description: NF20218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20218_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 36939056 - 36939278
Alignment:
| Q |
1 |
tgtgatttgtcacttaataaacttcaaaccttatctttctcatatgtgggacttgaggtttatccaatacatcatctcacactcaacactattgagtttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36939056 |
tgtgatttgtcacttaataaacttcagaccttatctttctcatatgtgggacttgaggtttatccaatacatcatctcacactcaacactattgagtttt |
36939155 |
T |
 |
| Q |
101 |
atagtgcatataaatggtgagtgacttaaaacgatacaatcttatatcatattaaattttttatatcggacataattcattcttataaaactaacttatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36939156 |
atagtgcatataaatggtgagtgacttgaaacgatacaatcttatatcatattaaatttttcatattggacataattcattcttataaaactaacttatt |
36939255 |
T |
 |
| Q |
201 |
aagatgaaatatcattctataaa |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36939256 |
aagatgaaatatcattctataaa |
36939278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University