View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20219_high_2 (Length: 563)
Name: NF20219_high_2
Description: NF20219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20219_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 466; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 466; E-Value: 0
Query Start/End: Original strand, 20 - 497
Target Start/End: Complemental strand, 45624544 - 45624067
Alignment:
| Q |
20 |
gccttcgtatacaaccctgacaaacctcgacaaaatggaccggcccgattcaaaccatgggacttaatagcagcagtttcagtctgcttaacaacaccaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45624544 |
gccttcgtatacaaccctgacaaacctcgacaaaatggaccggcccgattcaaaccatgggacttaatagcagcagtttcagtctgcttaacaacgccaa |
45624445 |
T |
 |
| Q |
120 |
ctttataccctgcactaacaagcctcctcacatggacatttaatcgaaaagttggtatgctagcagttaaaaaattatgatccatatgagcataaatacc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45624444 |
ctttataccctgcactaacaagcctcctcacatggacatttaatcgaaaagttggtatgctagcagttaaaaaattatgatccatatgagcataaatacc |
45624345 |
T |
 |
| Q |
220 |
caaaacccttgcagcattctcagcatcttcgccgaaaaatcgatacttgtaaccaacttcaatcattaaaagaacatcaggatacttagctttgagttcc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45624344 |
caaaacccttgcagcattctcagcatcttcgccgaaaaatcgatacttgtaaccaacttcaatcattaaaagaacatcagggtacttagctttgagttcc |
45624245 |
T |
 |
| Q |
320 |
actacctgatgctctaaaggagtaaactttacaggtttggaagatgaaggaggttgtggggttggattagaaggttctagaagcttctggaggaagcgtt |
419 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45624244 |
actacctgatgctctaaaggagtaaattttacaggtttggaagatgaaggaggttgtggggttggattagaaggttctagaagcttctggaggaagcgtt |
45624145 |
T |
 |
| Q |
420 |
ggtggagagagggaataggtgaagagagtttgggttgtttgttaggggatgctgtgagttgagagattaagcggcgtt |
497 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45624144 |
ggtggagagagggaataggtgaagagagtttgggttgtttgttaggggatgctgtgagttgagagattaagcggcgtt |
45624067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University