View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20222_high_19 (Length: 312)
Name: NF20222_high_19
Description: NF20222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20222_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 299
Target Start/End: Original strand, 4468550 - 4468849
Alignment:
| Q |
1 |
cgtaacgcctcaatggctagctcagttctagattcttgatcatgtgtaacacccccaacag-tagtaatagtcgttggagctgaacactgataaacgtcg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4468550 |
cgtaacgcctcaatggctagctcagttctagattcttgatcatgtgtaacacccccaacggctagtaatagtcgttggagctgaacactgataaacgtag |
4468649 |
T |
|
| Q |
100 |
tatgtaacgaaccctttgtcagtctctaacaactccttgtcagtgcctataaaatacatgcttctttcaccacaaatgcaaggtacacaatttgtcaatt |
199 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4468650 |
tatgtaacgaaccctttgtcaatctctaacaactccttgtcagtgcctataaaatacatgcttctttcaccacaaatgcaaggtacacaatttgtcaatt |
4468749 |
T |
|
| Q |
200 |
tatatccactttctatctcatactctttgctcaatcattgacttgaacgtcagagtgactgcaggtactgacctaacgtcaatctcgaccaattcatctc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4468750 |
tatatccactttctatctcatactctttgctcaatcattgacttgaacgtcagagtgactgcaggtactgacctaacgtcaatctcgaccaattcatctc |
4468849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University